ID: 908820294_908820297

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 908820294 908820297
Species Human (GRCh38) Human (GRCh38)
Location 1:68078784-68078806 1:68078810-68078832
Sequence CCACAAAACATCTAGGTGGCTCT CCTCAGTCTAGAAGCATGGTTGG
Strand - +
Off-target summary No data {0: 6, 1: 3, 2: 11, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!