ID: 908822461_908822465

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 908822461 908822465
Species Human (GRCh38) Human (GRCh38)
Location 1:68102518-68102540 1:68102543-68102565
Sequence CCAGACCCAGCTGGGGTTGTATC TTTGAAGGTCATCTGATTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!