ID: 908832075_908832077

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 908832075 908832077
Species Human (GRCh38) Human (GRCh38)
Location 1:68189589-68189611 1:68189613-68189635
Sequence CCTCTACCACGTGCTTCTTTTAT AAGACTAATCTCACTAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136} {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!