ID: 908878507_908878512

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 908878507 908878512
Species Human (GRCh38) Human (GRCh38)
Location 1:68704317-68704339 1:68704363-68704385
Sequence CCCTGGAGAGATAGGGGTTTAAT AAAGATTTGGGAAAGTCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 41, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!