ID: 908954110_908954116

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 908954110 908954116
Species Human (GRCh38) Human (GRCh38)
Location 1:69600312-69600334 1:69600349-69600371
Sequence CCAGGATATCCGGGATACCACAT TTGTTGCCATAGGCTCCTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} {0: 1, 1: 0, 2: 0, 3: 28, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!