ID: 909004663_909004667

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 909004663 909004667
Species Human (GRCh38) Human (GRCh38)
Location 1:70261108-70261130 1:70261125-70261147
Sequence CCCCCAAAATTCAATAGGTCCAT GTCCATGTAACGTAGTAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 202} {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!