ID: 909051987_909051993

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 909051987 909051993
Species Human (GRCh38) Human (GRCh38)
Location 1:70777196-70777218 1:70777230-70777252
Sequence CCCTCAATTTGCATTAACCTGCC ATGTAATTGAAAGCGAGTAGAGG
Strand - +
Off-target summary {0: 5, 1: 13, 2: 21, 3: 36, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!