ID: 909063937_909063943

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 909063937 909063943
Species Human (GRCh38) Human (GRCh38)
Location 1:70910264-70910286 1:70910284-70910306
Sequence CCCAGTTTCTGCCTAAAGCCACA ACAAGGCTGCCTGACAGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!