ID: 909153166_909153169

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 909153166 909153169
Species Human (GRCh38) Human (GRCh38)
Location 1:72034933-72034955 1:72034973-72034995
Sequence CCAGGTACATTCAATATGGCAGT TCACCACGTTTATGGTGTCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 19, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!