ID: 909268384_909268391

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 909268384 909268391
Species Human (GRCh38) Human (GRCh38)
Location 1:73591731-73591753 1:73591758-73591780
Sequence CCTCCAGGGAATTTACCCTCTAA CCAACTTGGAAGCAGAGACCAGG
Strand - +
Off-target summary No data {0: 2, 1: 33, 2: 105, 3: 160, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!