ID: 909308841_909308850

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 909308841 909308850
Species Human (GRCh38) Human (GRCh38)
Location 1:74119693-74119715 1:74119739-74119761
Sequence CCCACCAAATTAAAATAATACTC ATATACACAGCTCTTTTTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 14, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!