|
Left Crispr |
Right Crispr |
| Crispr ID |
909316338 |
909316349 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:74223981-74224003
|
1:74224031-74224053
|
| Sequence |
CCCTCCTCCTGCTGATTATAGAG |
TAGCCAGGTAGAGGTTATAGTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 7, 2: 52, 3: 108, 4: 248} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|