ID: 909324609_909324617

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 909324609 909324617
Species Human (GRCh38) Human (GRCh38)
Location 1:74334637-74334659 1:74334689-74334711
Sequence CCCACATGCTTCATTACTTTATC AGTTAAATGGAGAAGATGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 35, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!