ID: 909329645_909329651

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 909329645 909329651
Species Human (GRCh38) Human (GRCh38)
Location 1:74396138-74396160 1:74396167-74396189
Sequence CCATCTCAAACATCTCACAAAGT CAGGGAGATCAGAGGGCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 73, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!