ID: 909344887_909344892

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 909344887 909344892
Species Human (GRCh38) Human (GRCh38)
Location 1:74573169-74573191 1:74573194-74573216
Sequence CCCTTCTGCTTCTGCTGCTCCCT GCCCCCCTTTCTATGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 93, 4: 947} {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!