ID: 909346157_909346162

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 909346157 909346162
Species Human (GRCh38) Human (GRCh38)
Location 1:74590004-74590026 1:74590021-74590043
Sequence CCCCACTGCAGATTCATCCTCAC CCTCACTGTCACTAGAATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 332} {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!