ID: 909352737_909352749

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 909352737 909352749
Species Human (GRCh38) Human (GRCh38)
Location 1:74673625-74673647 1:74673660-74673682
Sequence CCGAGGTCCCCTGTGCGCGGGCA CGCCGCCGCCCCTGGGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 0, 2: 5, 3: 52, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!