ID: 909352742_909352749

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 909352742 909352749
Species Human (GRCh38) Human (GRCh38)
Location 1:74673634-74673656 1:74673660-74673682
Sequence CCTGTGCGCGGGCACCTGGGCTG CGCCGCCGCCCCTGGGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 179} {0: 1, 1: 0, 2: 5, 3: 52, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!