ID: 909358786_909358788

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 909358786 909358788
Species Human (GRCh38) Human (GRCh38)
Location 1:74738407-74738429 1:74738441-74738463
Sequence CCGTTATGGAATTAAATAAAGTA CTTCAAAGCACACTAATAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 54, 4: 484} {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!