ID: 909432480_909432487

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 909432480 909432487
Species Human (GRCh38) Human (GRCh38)
Location 1:75605649-75605671 1:75605689-75605711
Sequence CCTAATGGGAAACTACCAAAAGT CTATGGGAATCCACAGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 167} {0: 1, 1: 0, 2: 4, 3: 27, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!