ID: 909432481_909432489

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 909432481 909432489
Species Human (GRCh38) Human (GRCh38)
Location 1:75605664-75605686 1:75605706-75605728
Sequence CCAAAAGTTATAAAATTCGATTA AGGGGGTAAAGAGAAAGCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 67, 4: 651}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!