ID: 909453412_909453415

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 909453412 909453415
Species Human (GRCh38) Human (GRCh38)
Location 1:75823787-75823809 1:75823817-75823839
Sequence CCCTGCAGAGGTCATGAACTCAT AATGGCTGCATAGTATTCCATGG
Strand - +
Off-target summary No data {0: 392, 1: 25685, 2: 13905, 3: 8104, 4: 5431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!