ID: 909475495_909475501

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 909475495 909475501
Species Human (GRCh38) Human (GRCh38)
Location 1:76076522-76076544 1:76076575-76076597
Sequence CCTTAGTTTCTTCAATATAAGAT CTGTGGGAATGAAATAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 432} {0: 1, 1: 0, 2: 3, 3: 22, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!