ID: 909577800_909577805

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 909577800 909577805
Species Human (GRCh38) Human (GRCh38)
Location 1:77195001-77195023 1:77195033-77195055
Sequence CCAAACTCCACCAAGCTCCTGCA CCTGAATCTGCTCAGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 323} {0: 2, 1: 0, 2: 0, 3: 24, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!