ID: 909577814_909577817

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 909577814 909577817
Species Human (GRCh38) Human (GRCh38)
Location 1:77195085-77195107 1:77195102-77195124
Sequence CCAGACTGGTGAGGTGTGGTCAT GGTCATATTACACAGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 156} {0: 2, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!