|
Left Crispr |
Right Crispr |
| Crispr ID |
909612985 |
909612991 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:77572727-77572749
|
1:77572750-77572772
|
| Sequence |
CCCAGGCTCAAGTGATCCTCCCA |
TCTCAGCCTCTTGAGTAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 455, 2: 14212, 3: 131727, 4: 229718} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|