ID: 909617543_909617545

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 909617543 909617545
Species Human (GRCh38) Human (GRCh38)
Location 1:77628609-77628631 1:77628650-77628672
Sequence CCTTATATGGGATATCTTTGCAC AAGCTGAACACTAGGATAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!