ID: 909625990_909625993

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 909625990 909625993
Species Human (GRCh38) Human (GRCh38)
Location 1:77716620-77716642 1:77716633-77716655
Sequence CCGGTAAATCAAAGGTTAGTCTT GGTTAGTCTTAGGACCACATGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 8, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!