ID: 909636406_909636412

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 909636406 909636412
Species Human (GRCh38) Human (GRCh38)
Location 1:77821265-77821287 1:77821292-77821314
Sequence CCACATCTTCCCTCATTTATTCC CAGTTGTTCTTTTGGACCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 550} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!