ID: 909659064_909659074

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 909659064 909659074
Species Human (GRCh38) Human (GRCh38)
Location 1:78062372-78062394 1:78062423-78062445
Sequence CCTTCCTTCTTCTGTGTTCTCTG TGCCTGTATGTAAAAGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 90, 4: 885} {0: 1, 1: 0, 2: 1, 3: 11, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!