ID: 909662269_909662274

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 909662269 909662274
Species Human (GRCh38) Human (GRCh38)
Location 1:78097317-78097339 1:78097366-78097388
Sequence CCAGTCTTAGTGAGGCAGAGTTT GCTGTAGCTAAGTCACTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 179} {0: 1, 1: 0, 2: 1, 3: 5, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!