ID: 909685110_909685119

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 909685110 909685119
Species Human (GRCh38) Human (GRCh38)
Location 1:78339294-78339316 1:78339324-78339346
Sequence CCTTCCTCATCCCACCTCCCCAT TCTTCCTCCCTACCCTACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 187, 4: 1671} {0: 1, 1: 1, 2: 1, 3: 36, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!