ID: 909695254_909695257

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 909695254 909695257
Species Human (GRCh38) Human (GRCh38)
Location 1:78461333-78461355 1:78461348-78461370
Sequence CCTTGCTGTAGTTGTTTATCAGG TTATCAGGCCTAGGAACCTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 75, 4: 267} {0: 1, 1: 0, 2: 13, 3: 102, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!