ID: 909734095_909734099

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 909734095 909734099
Species Human (GRCh38) Human (GRCh38)
Location 1:78934439-78934461 1:78934465-78934487
Sequence CCATAAAACTCCTAGAAGAAAAT GGTAATACCATTTAGGACATAGG
Strand - +
Off-target summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!