|
Left Crispr |
Right Crispr |
| Crispr ID |
909737739 |
909737742 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:78985948-78985970
|
1:78985974-78985996
|
| Sequence |
CCTTATAAGTGGGAGCTAAACAT |
GTATATGTGGATATAAAGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 14, 1: 53, 2: 86, 3: 154, 4: 358} |
{0: 1, 1: 0, 2: 11, 3: 152, 4: 825} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|