ID: 909944435_909944437

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 909944435 909944437
Species Human (GRCh38) Human (GRCh38)
Location 1:81648005-81648027 1:81648035-81648057
Sequence CCTATTTAGATGTGGGTCACTAG AATGCAAAGAAAACCAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71} {0: 1, 1: 0, 2: 6, 3: 77, 4: 811}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!