ID: 910049072_910049076

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 910049072 910049076
Species Human (GRCh38) Human (GRCh38)
Location 1:82955774-82955796 1:82955801-82955823
Sequence CCGTCCTCCTGCTCTTTGCTCTG AAAGATCCACCTATGACCTCGGG
Strand - +
Off-target summary No data {0: 158, 1: 377, 2: 219, 3: 116, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!