ID: 910061616_910061624

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 910061616 910061624
Species Human (GRCh38) Human (GRCh38)
Location 1:83100357-83100379 1:83100408-83100430
Sequence CCCACGTAAGAGCATTTATTCCC GAGGCTATATGATTGCATCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!