ID: 910131450_910131456

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 910131450 910131456
Species Human (GRCh38) Human (GRCh38)
Location 1:83912130-83912152 1:83912177-83912199
Sequence CCCATGCTACATTTTAAAAATTA GGGTAAATTTTCATGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 110, 4: 910} {0: 1, 1: 0, 2: 2, 3: 22, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!