ID: 910169987_910169989

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 910169987 910169989
Species Human (GRCh38) Human (GRCh38)
Location 1:84367468-84367490 1:84367482-84367504
Sequence CCAACCTCAGGCATTGAAAGGCC TGAAAGGCCCAGAATTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156} {0: 1, 1: 0, 2: 2, 3: 16, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!