ID: 910216331_910216341

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 910216331 910216341
Species Human (GRCh38) Human (GRCh38)
Location 1:84848271-84848293 1:84848308-84848330
Sequence CCGCCAAGAAAGCCTTCAACTTA CCCCTGCTGGGCCCTGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 77, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!