|
Left Crispr |
Right Crispr |
| Crispr ID |
910219424 |
910219428 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:84875550-84875572
|
1:84875569-84875591
|
| Sequence |
CCATGGGATGGCCCTTGCCAGAT |
AGATGCCAGTGCCAAGCTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 7, 2: 32, 3: 61, 4: 198} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|