ID: 910220013_910220016

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 910220013 910220016
Species Human (GRCh38) Human (GRCh38)
Location 1:84880553-84880575 1:84880579-84880601
Sequence CCAAGTCCATGCTGCAGAGGACC GAGTACACACTACTGAAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!