ID: 910243366_910243370

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 910243366 910243370
Species Human (GRCh38) Human (GRCh38)
Location 1:85112440-85112462 1:85112458-85112480
Sequence CCTGGGTACATCCCTAGGAATAG AATAGAATGGTTGTATTATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 137} {0: 1, 1: 1, 2: 3, 3: 54, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!