ID: 910268248_910268251

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 910268248 910268251
Species Human (GRCh38) Human (GRCh38)
Location 1:85364248-85364270 1:85364263-85364285
Sequence CCTTCTGCCTTCCAATTCTGTAC TTCTGTACATTTAAGTCCACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!