ID: 910280467_910280472

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 910280467 910280472
Species Human (GRCh38) Human (GRCh38)
Location 1:85495008-85495030 1:85495037-85495059
Sequence CCTGCTTTTGCCATCTTACTGCT CAGTTCCAGCAGAGGGCAGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 39, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!