|
Left Crispr |
Right Crispr |
| Crispr ID |
910286120 |
910286124 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:85556141-85556163
|
1:85556154-85556176
|
| Sequence |
CCTTCCTCCTTCTCCTCCTTCTC |
CCTCCTTCTCCTCCTTCCCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296} |
{0: 1, 1: 2, 2: 36, 3: 266, 4: 1411} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|