ID: 910286120_910286134

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 910286120 910286134
Species Human (GRCh38) Human (GRCh38)
Location 1:85556141-85556163 1:85556190-85556212
Sequence CCTTCCTCCTTCTCCTCCTTCTC AAAATGTTCCTCATTACTGCTGG
Strand - +
Off-target summary {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296} {0: 1, 1: 0, 2: 2, 3: 25, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!