ID: 910310818_910310821

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 910310818 910310821
Species Human (GRCh38) Human (GRCh38)
Location 1:85822614-85822636 1:85822654-85822676
Sequence CCTGTGTTACATAGTCAAACTAC TATGACAATGATTCTTTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 128} {0: 1, 1: 1, 2: 15, 3: 71, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!