ID: 910315484_910315486

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 910315484 910315486
Species Human (GRCh38) Human (GRCh38)
Location 1:85877656-85877678 1:85877700-85877722
Sequence CCCAGCTTCATGTGTGTTTTTAA TTATATTAAAAAGAAAAGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 23, 3: 209, 4: 1935}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!